MCAT Chemical and Physical Foundations Practice Test 2
Exam Summary
0 of 10 Questions completed
Questions:
Information
You have already completed the exam before. Hence you can not start it again.
Exam is loading…
You must sign in or sign up to start the exam.
You must first complete the following:
Results
Results
0 of 10 Questions answered correctly
Your time:
Time has elapsed
You have reached 0 of 0 point(s), (0)
Earned Point(s): 0 of 0, (0)
0 Essay(s) Pending (Possible Point(s): 0)
Average score |
|
Your score |
|
Categories
- Not categorized 0%
- 1
- 2
- 3
- 4
- 5
- 6
- 7
- 8
- 9
- 10
- Current
- Review
- Answered
- Correct
- Incorrect
-
Question 1 of 10
1. Question
Perchloric acid (HClO4) is considered one of the stronger acids in existence. Which of the following statements corresponds most accurately with strong acids?
CorrectIncorrect -
Question 2 of 10
2. Question
A high school science teacher fills a 1 liter bottle with pure nitrogen and seals the lid. The pressure is 1.70 atm, and the room temperature is 25°C. Which two variables will both increase the pressure of the system, if all other variables are held constant?
CorrectIncorrect -
Question 3 of 10
3. Question
Which of the following descriptions (compound-titrating solution) would accurately describe the process carried out here?
A titratable compound is subjected to titration in the lab. The curve is shown above:
CorrectIncorrect -
Question 4 of 10
4. Question
A 1 meter tall jug of water, while sitting on a countertop 2 meters high with its lid open, springs a leak from a weak spot in the plastic at the very bottom of the side. How fast will water empty from the jug?
CorrectIncorrect -
Question 5 of 10
5. Question
The given values for this circuit are R1 = 5Ω, R2 = 10Ω, R3 = 15Ω, and V = 8.1V. Which of the following would change the current to 6.0A?
A resistor circuit diagram is given above:
CorrectIncorrect -
Question 6 of 10
6. Question
While working on a scene for an action movie, a sound technician is given the task of changing the frequency of a gunshot to more accurately reflect the normal speed of sound. The gunshot came from an actor inside a car traveling 108 km/h, and it was recorded by a camera on a platform 200 meters away traveling at 72 km/h in the same direction. If the frequency of the gunshot is normally 800Hz, what is the perceived frequency which the camera picks up the gunshot at?
CorrectIncorrect -
Question 7 of 10
7. Question
A descript amount of 2-bromobutane is placed into a strong solution of ethanol and allowed to complete a reaction. The result of this reaction produces a major product of 2-butene and a minor product of 1-butene. Which of the following descriptions of the starting compound explains why 2-butene is the major product?
CorrectIncorrect -
Question 8 of 10
8. Question
During DNA replication, mistakes are coded into the leading strand about once every 100,000/1 million copies. This DNA is subject to proofreading by several mechanisms. If a mistake is noted and the incorrect base is removed shortly following the time RNA primer is removed, this would most likely be the work of which repair mechanism?
CorrectIncorrect -
Question 9 of 10
9. Question
One of the many reasons that the eukaryotic cell can possess so much information in its DNA is the ability to condense coding regions when they are not being expressed. When acting on DNA, which of the following processes will usually lead to a decrease in gene expression?
CorrectIncorrect -
Question 10 of 10
10. Question
What is the most likely outcome of this modification?
An RNA strand that normally produces a transmembrane protein that facilitates potassium entry into muscle cells is modified to produce a different strand. The original strand is as follows:
GAAUAGAUGGGAAGCGCCAGAUACAGUAACAGA…
The modified sequence is as follows:
GAAUAGAUGGGAAGCGCCAGAUACAGUACCAGA…
CorrectIncorrect